missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Codice prodotto. 10384680 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM, 45 μL
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità unitSize
10384680 10 μM, 45 μL Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
Codice prodotto. 10384680 Fornitore Thermo Scientific™ N. del fornitore SO114

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

TRUSTED_SUSTAINABILITY

Specifica

Product Type Sequencing Primer
Content And Storage M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer M13
Quantità 10 μM, 45 μL
Vettore pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Titolo del prodotto
Selezionare un problema

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.