missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10384680

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Codice prodotto. 10384680 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM, 45 μL
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità unitSize
10384680 10 μM, 45 μL Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
Codice prodotto. 10384680 Fornitore Thermo Scientific™ N. del fornitore SO114

This item is currently unavailable or has been discontinued.
View the product page for possible alternatives.
 Ver productos alternativos

Este artículo no se puede devolver. Vea la política de devoluciones

Descripción

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

TRUSTED_SUSTAINABILITY

Especificaciones

Product Type Sequencing Primer
Content And Storage M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer M13
Quantità 10 μM, 45 μL
Vettore pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Título del producto
Seleccione un problema

Al hacer clic en Enviar, acepta que Fisher Scientific se ponga en contacto con usted en relación con los comentarios que ha proporcionado en este formulario. No compartiremos su información para ningún otro fin. Toda la información de contacto proporcionada se mantendrá de acuerdo con nuestra Política de Privacidad. Política de privacidad.