missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer

Codice prodotto. 10756231 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM, 42 μL
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità Dimensione della confezione
10756231 10 μM, 42 μL Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
Codice prodotto. 10756231 Fornitore Thermo Scientific™ N. del fornitore SO115

This item is currently unavailable or has been discontinued.
View the product page for possible alternatives.
Visualizzare prodotti alternativi

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

TRUSTED_SUSTAINABILITY

Specifica

Product Type Sequencing Primer
Content And Storage M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer M13
Quantità 10 μM, 42 μL
Vettore pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Titolo del prodotto
Selezionare un problema

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.