Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Sfoglia Tutto Thermo Scientific ProdottiDescrizione
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'
Specifica
Specifica
| Product Type | Sequencing Primer |
| Content And Storage | M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentrazione | 10 μM |
| Primer | M13 |
| Quantità | 10 μM, 42 μL |
| Vettore | pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II |
| Da utilizzare con (applicazione) | Sequencing |
| Forma | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.