missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer

Codice prodotto. 10590091 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità unitSize
10590091 10 μM Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
\u00C8 possible ordinare fino a esaurimento dello stock disponibile. Qualora un articolo alternativo sia stato identificato, lo stesso sar\u00E0 visibile qui di seguito
Codice prodotto. 10590091 Fornitore Thermo Scientific™ N. del fornitore SO501

Please to purchase this item. Need a web account? Register with us today!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
\u00C8 possible ordinare fino a esaurimento dello stock disponibile. Qualora un articolo alternativo sia stato identificato, lo stesso sar\u00E0 visibile qui di seguito

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)

TRUSTED_SUSTAINABILITY

Specifica

Product Type Forward Sequencing Primer
Content And Storage T3 promoter Sequencing Primer, 24-mer, 10 μM

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer pJET
Quantità 10 μM
Vettore pJET1.2
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Titolo del prodotto
Selezionare un problema

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.