Learn More
Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer
Sfoglia Tutto Thermo Scientific ProdottiDescrizione
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)
Specifica
Specifica
| Product Type | Forward Sequencing Primer |
| Content And Storage | pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL) Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentrazione | 10 μM |
| Primer | pJET |
| Quantità | 10 μM, 84 μL |
| Vettore | pJET1.2 |
| Da utilizzare con (applicazione) | Sequencing |
| Forma | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.