missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10659920

Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer

Codice prodotto. 10659920 Sfoglia Tutto Thermo Scientific Prodotti
Click to view available options
Quantità:
10 μM, 84 μL
Dimensione della confezione:
Pezzo
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Codice prodotto. 10659920

Marca: Thermo Scientific™ SO511

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

53.70 EUR valido fino al 2025-12-19
MIGLIOR PREZZO in promozione! Usa il codice promo "24110" per avere il tuo prezzo promozionale.
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Descrizione

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)

TRUSTED_SUSTAINABILITY

Specifica

Product Type Forward Sequencing Primer
Content And Storage pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer pJET
Quantità 10 μM, 84 μL
Vettore pJET1.2
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Correzione del contenuto del prodotto

Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.

Titolo del prodotto

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.

Grazie per averci aiutato a migliorare il nostro sito web. Il vostro feedback è stato inviato