missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10659920

Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer

Codice prodotto. 10659920 Sfoglia Tutto Thermo Scientific Prodotti
Click to view available options
Quantità:
10 μM, 84 μL
Dimensione della confezione:
Pezzo
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Codice prodotto. 10659920

Marca: Thermo Scientific™ SO511

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Description

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)

TRUSTED_SUSTAINABILITY

Specifications

Product Type Forward Sequencing Primer
Content And Storage pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer pJET
Quantità 10 μM, 84 μL
Vettore pJET1.2
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.