Learn More
Descrizione
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
Specifica
Specifica
| Promotore | SP6, T3, T7 |
| Product Type | Sequencing Primer |
| Content And Storage | SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentrazione | 10 μM |
| Primer | SP6 |
| Quantità | 10 μM, 42 μL |
| Vettore | pTZ19R, pTZ57R, pBluescript II |
| Da utilizzare con (applicazione) | Sequencing |
| Forma | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.