missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer

Codice prodotto. 10223130 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM, 42 μL
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità unitSize
10223130 10 μM, 42 μL Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
Codice prodotto. 10223130 Fornitore Thermo Scientific™ N. del fornitore SO117

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

TRUSTED_SUSTAINABILITY

Specifica

Promotore SP6, T3, T7
Product Type Sequencing Primer
Content And Storage SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer SP6
Quantità 10 μM, 42 μL
Vettore pTZ19R, pTZ57R, pBluescript II
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Titolo del prodotto
Selezionare un problema

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.