missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ T3 promoter Sequencing Primer, 24-mer

Codice prodotto. 10121330 Sfoglia Tutto Thermo Scientific Prodotti
Click to view available options
Quantità:
10 μM, 42 μL
Dimensione della confezione:
Pezzo
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Codice prodotto. 10121330

Marca: Thermo Scientific™ SO120

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

TRUSTED_SUSTAINABILITY

Specifica

Promotore SP6, T3, T7
Product Type Sequencing Primer
Content And Storage T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer T3
Quantità 10 μM, 42 μL
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Correzione del contenuto del prodotto

Fornite il vostro feedback sul contenuto del prodotto compilando il modulo sottostante.

Titolo del prodotto

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.

Grazie per averci aiutato a migliorare il nostro sito web. Il vostro feedback è stato inviato