missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ T7 promoter Sequencing Primer, 20-mer

Codice prodotto. 10598360 Sfoglia Tutto Thermo Scientific Prodotti
Cambia vista
Click to view available options
Quantità:
10 μM
Dimensione della confezione:
Pezzo
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Codice prodotto. Quantità unitSize
10598360 10 μM Pezzo
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”27968” to get your promotional price
Codice prodotto. 10598360 Fornitore Thermo Scientific™ N. del fornitore SO118

Effettua il per acquistare questo articolo Hai bisogno di un conto web ? Registrati oggi stesso!

Les retours ne sont pas autorisés pour ce produit. Consulta la politica di reso
To receive the discount customers must purchase three of the same product at list price in a single order to receive 33% discount. There is no limit to the multiples of 3 that customers can buy. Use promo code ”27968” to get your promotional price

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter sequences 5'-d (TAATACGACTCACTATAGGG)-3'

Related products
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T3 promoter Sequencing Primer, 24-mer (SO120)
SP6 promoter Sequencing Primer, 18-mer (SO116)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.

TRUSTED_SUSTAINABILITY

Specifica

Promotore SP6, T3, T7
Product Type Sequencing Primer
Content And Storage T7 promoter Sequencing Primer, 20-mer, 10 μM

Store at –20°C.
Shipping Condition Dry Ice
Concentrazione 10 μM
Primer T7
Quantità 10 μM
Vettore pTZ19R, pTZ57R, pBluescript II
Da utilizzare con (applicazione) Sequencing
Forma Liquid

For Research Use Only. Not for use in diagnostic procedures.

Titolo del prodotto
Selezionare un problema

Facendo clic su Invia, l'utente riconosce che potrebbe essere contattato da Fisher Scientific in merito al feedback fornito in questo modulo. Non condivideremo le vostre informazioni per altri scopi. Tutte le informazioni di contatto fornite saranno conservate in conformità con la nostra Politica sulla privacy. Informativa sulla privacy.